Please use this identifier to cite or link to this item:
http://hdl.handle.net/1942/48649Full metadata record
| DC Field | Value | Language |
|---|---|---|
| dc.date.accessioned | 2026-03-02T07:20:27Z | - |
| dc.date.available | 2026-03-02T07:20:27Z | - |
| dc.date.issued | 2021 | - |
| dc.date.submitted | 2026-02-27T15:14:36Z | - |
| dc.identifier.citation | Zenodo. 10.5281/zenodo.16056123 https://zenodo.org/doi/10.5281/zenodo.16056123 | - |
| dc.identifier.uri | http://hdl.handle.net/1942/48649 | - |
| dc.description.abstract | TABLE 1 Primers and PCR protocols PrimersSequence (5'→3')UsageReference18STimAAMCTGGTTGATCCTGCCAGPCR/SeqNorén and Jondelius (1999)TimBTGATCCATCTGCAGGTTCACCTPCR/SeqNorén and Jondelius (1999)TimA/TimB PCR regime:5 min 10 s at 95°C, 30x (30 s at 94°C, 30 s at 55°C, 90 s at 72°C), 5 min at 72°C600FGGTGCCAGCAGCCGCGGTSeqWillems et al. (2006)600RACCGCGGCTGCTGGCACCSeqWillems et al. (2006)1100FCAGAGGTTCGAAGACGATCSeqNorén and Jondelius (1999)1100RGATCGTCTTCGAACCTCTGSeqNorén and Jondelius (1999)18S7FGCAATAACAGGTCTGTGATGCSeqNorén and Jondelius (1999)18S7FKGCATCACAGACCTGTTATTGCSeqNorén and Jondelius (1999)TimBTGATCCATCTGCAGGTTCACCTSeqNorén and Jondelius (1999)28SLSU5TAGGTCGACCCGCTGAAYTTAPCR/SeqLittlewood et al. (2000)LSUD6-3GGAACCCTTCTCCACTTCAGTCPCR/SeqLittlewood et al. (2000)LSU5/LSUD6-3 PCR regime:5 min at 95°C, 30x (60 s at 94°C, 60 s at 50°C, 90 s at 72°C), 5 min at 72°CL300FCAAGTACCGTGAGGGAAAGTTGSeqLittlewood et al. (2000)L300RCAACTTTCCCTCACGGTACTTGSeqLittlewood et al. (2000)L1600FGCAGGACGGTGGCCATGGAAGSeqLittlewood et al. (2000)L1600RCTTCCATGGCCACCGTCCTGCSeqLittlewood et al. (2000)5.8S+ITS258SITS2F1GCGGTGGATCACTCGGCTCGPCR/SeqThis study58SITS2R1TCGCTCGCCGCTACTRRGGGAPCR/SeqThis study58ITS2F/58ITS2R PCR regime:5 min at 95°C, 35x (60 s at 94°C, 60 s at 55°C, 72 s at 72°C), 5 min at 72°C | - |
| dc.description.sponsorship | Fonds Wetenschappelijk Onderzoek, Grant/Award Number: G.08.208.08 and W0.009.11N (BeBol); Belgian Federal Science Policy Office; European Marine Biological Resource Centre Belgium, Grant/Award Number: FWO project GOH3817. | - |
| dc.description.sponsorship | FWO project G.08.208.08, the FWO research network W0.009.11N (BeBol), the BELSPO–IAP project SPEEDY and personal FWO grants to Bart Tessens and Marlies Monnens | - |
| dc.description.sponsorship | The research leading to results presented in this publication was carried out with infrastructure funded by EMBRC Belgium - FWO project GOH3817N. Financial support was provided by the Belgian Science Policy Office (BELSPO) through the ‘Joint Experimental Molecular Unit' (JEMU: http://jemu. myspecies.info/) at RBINS and RMCA. Additional collection campaigns were funded by FWO | - |
| dc.language.iso | en | - |
| dc.publisher | Zenodo | - |
| dc.subject.classification | Phylogeny and comparative analysis | - |
| dc.subject.other | Biodiversity | - |
| dc.subject.other | Taxonomy | - |
| dc.title | TABLE 1 in Is ' everything everywhere'? Unprecedented cryptic diversity in the cosmopolitan flatworm Gyratrix hermaphroditus | - |
| dc.type | Dataset | - |
| local.bibliographicCitation.jcat | DS | - |
| dc.description.version | V1 | - |
| dc.identifier.doi | 10.5281/zenodo.16056123 | - |
| dc.identifier.url | https://zenodo.org/doi/10.5281/zenodo.16056123 | - |
| local.provider.type | datacite | - |
| local.uhasselt.international | no | - |
| local.contributor.datacreator | TESSENS, Bart | - |
| local.contributor.datacreator | MONNENS, Marlies | - |
| local.contributor.datacreator | Backeljau, Thierry | - |
| local.contributor.datacreator | Jordaens, Kurt | - |
| local.contributor.datacreator | Steenkiste, Niels Van | - |
| local.contributor.datacreator | Breman, Floris C. | - |
| local.contributor.datacreator | SMEETS, Karen | - |
| local.contributor.datacreator | ARTOIS, Tom | - |
| local.contributor.rightsholder | TESSENS, Bart | - |
| local.format.extent | 3.4 kB | - |
| local.format.mimetype | .html | - |
| local.publication.doi | 10.1111/zsc.12507 | - |
| local.publication.handle | http://hdl.handle.net/1942/34714 | - |
| local.contributingorg.datacreator | Research Group Zoology: Biodiversity and Toxicology, Centre for Environmental Sciences, Hasselt University, Diepenbeek, Belgium | - |
| local.contributingorg.rightsholder | Research Group Zoology: Biodiversity and Toxicology, Centre for Environmental Sciences, Hasselt University, Diepenbeek, Belgium | - |
| dc.rights.access | Closed Access | - |
| item.fullcitation | TESSENS, Bart; MONNENS, Marlies; Backeljau, Thierry; Jordaens, Kurt; Steenkiste, Niels Van; Breman, Floris C.; SMEETS, Karen & ARTOIS, Tom (2021) TABLE 1 in Is ' everything everywhere'? Unprecedented cryptic diversity in the cosmopolitan flatworm Gyratrix hermaphroditus. Zenodo. 10.5281/zenodo.16056123 https://zenodo.org/doi/10.5281/zenodo.16056123. | - |
| item.accessRights | Closed Access | - |
| item.fulltext | No Fulltext | - |
| item.contributor | TESSENS, Bart | - |
| item.contributor | MONNENS, Marlies | - |
| item.contributor | Backeljau, Thierry | - |
| item.contributor | Jordaens, Kurt | - |
| item.contributor | Steenkiste, Niels Van | - |
| item.contributor | Breman, Floris C. | - |
| item.contributor | SMEETS, Karen | - |
| item.contributor | ARTOIS, Tom | - |
| crisitem.discipline.code | 01060507 | - |
| crisitem.discipline.name | Phylogeny and comparative analysis | - |
| crisitem.discipline.path | Natural sciences > Biological sciences > Evolutionary biology > Phylogeny and comparative analysis | - |
| crisitem.discipline.pathandcode | Natural sciences > Biological sciences > Evolutionary biology > Phylogeny and comparative analysis (01060507) | - |
| Appears in Collections: | Datasets | |
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.