Please use this identifier to cite or link to this item:
http://hdl.handle.net/1942/48649| Title: | TABLE 1 in Is ' everything everywhere'? Unprecedented cryptic diversity in the cosmopolitan flatworm Gyratrix hermaphroditus | Data Creator - person: | TESSENS, Bart MONNENS, Marlies Backeljau, Thierry Jordaens, Kurt Steenkiste, Niels Van Breman, Floris C. SMEETS, Karen ARTOIS, Tom |
Data Creator - organization: | Research Group Zoology: Biodiversity and Toxicology, Centre for Environmental Sciences, Hasselt University, Diepenbeek, Belgium | Rights Holder - person: | TESSENS, Bart | Rights Holder - organization: | Research Group Zoology: Biodiversity and Toxicology, Centre for Environmental Sciences, Hasselt University, Diepenbeek, Belgium | Publisher: | Zenodo | Issue Date: | 2021 | Abstract: | TABLE 1 Primers and PCR protocols PrimersSequence (5'→3')UsageReference18STimAAMCTGGTTGATCCTGCCAGPCR/SeqNorén and Jondelius (1999)TimBTGATCCATCTGCAGGTTCACCTPCR/SeqNorén and Jondelius (1999)TimA/TimB PCR regime:5 min 10 s at 95°C, 30x (30 s at 94°C, 30 s at 55°C, 90 s at 72°C), 5 min at 72°C600FGGTGCCAGCAGCCGCGGTSeqWillems et al. (2006)600RACCGCGGCTGCTGGCACCSeqWillems et al. (2006)1100FCAGAGGTTCGAAGACGATCSeqNorén and Jondelius (1999)1100RGATCGTCTTCGAACCTCTGSeqNorén and Jondelius (1999)18S7FGCAATAACAGGTCTGTGATGCSeqNorén and Jondelius (1999)18S7FKGCATCACAGACCTGTTATTGCSeqNorén and Jondelius (1999)TimBTGATCCATCTGCAGGTTCACCTSeqNorén and Jondelius (1999)28SLSU5TAGGTCGACCCGCTGAAYTTAPCR/SeqLittlewood et al. (2000)LSUD6-3GGAACCCTTCTCCACTTCAGTCPCR/SeqLittlewood et al. (2000)LSU5/LSUD6-3 PCR regime:5 min at 95°C, 30x (60 s at 94°C, 60 s at 50°C, 90 s at 72°C), 5 min at 72°CL300FCAAGTACCGTGAGGGAAAGTTGSeqLittlewood et al. (2000)L300RCAACTTTCCCTCACGGTACTTGSeqLittlewood et al. (2000)L1600FGCAGGACGGTGGCCATGGAAGSeqLittlewood et al. (2000)L1600RCTTCCATGGCCACCGTCCTGCSeqLittlewood et al. (2000)5.8S+ITS258SITS2F1GCGGTGGATCACTCGGCTCGPCR/SeqThis study58SITS2R1TCGCTCGCCGCTACTRRGGGAPCR/SeqThis study58ITS2F/58ITS2R PCR regime:5 min at 95°C, 35x (60 s at 94°C, 60 s at 55°C, 72 s at 72°C), 5 min at 72°C | Research Discipline: | Natural sciences > Biological sciences > Evolutionary biology > Phylogeny and comparative analysis (01060507) | Keywords: | Biodiversity;Taxonomy | DOI: | 10.5281/zenodo.16056123 | Link to publication/dataset: | https://zenodo.org/doi/10.5281/zenodo.16056123 | Source: | Zenodo. 10.5281/zenodo.16056123 https://zenodo.org/doi/10.5281/zenodo.16056123 | Publications related to the dataset: | 10.1111/zsc.12507 | Publications related to the dataset: | http://hdl.handle.net/1942/34714 | Access Rights: | Closed Access | Version: | V1 | Category: | DS | Type: | Dataset |
| Appears in Collections: | Datasets |
Show full item record
Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.